DNA fingerprinting can be utilized as a means of identifying people. I actually work as a DNA analyst for a crime laboratory and we utilize a type of DNA fingerprinting technique for catching criminals. We look at short tandem repeats (STRs), which are areas in the DNA that have three to four base pair repeats (e.g. AGATAGATAGATAGATAGAT). We are able to amplify or copy several different regions (called loci) of DNA that are known to have these repeat sequences. A region or loci with more repeats will be longer (because there are more base pairs). As such, we are able to determine the number of repeats in a particular locus by how long these regions are. For example, TPOX is a STR we use. You might have 8 repeats in TPOX region. Since you get one copy of your DNA from mom and the other from dad, some regions will have two different repeat numbers. For example, you might be an 8 and 9 repeat for TPOX. We look at many different regions of your DNA, which allow us to put together a genetic profile that can be used to identify you (your genetic fingerprint).

When we get evidence in, we look biological material that may be there (like blood) and then isolate the DNA. We then quantify the DNA and amplify it using special chemicals that allow us to figure out the genetic profile of the person that left the biological material on the evidence. This is then compared to the known profile of any suspects or other people that may have had contact with the evidence.

I'm afraid I work with plants, and what we do with them is is called "microsatellite markers". They help us know which plants are related to which other plants.