UCSB Science Line
Sponge Spicules Nerve Cells Galaxy Abalone Shell Nickel Succinate X-ray Lens Lupine
UCSB Science Line
Home
How it Works
Ask a Question
Search Topics
Webcasts
Our Scientists
Science Links
Contact Information
Hello! I'm doing a project on DNA fingerprinting for the last project of the trimester. When you studied about DNA fingerprinting, what was your favorite part? Or do you have any other interesting information? :) Thanks :)
Answer 1:

DNA fingerprinting can be utilized as a means of identifying people. I actually work as a DNA analyst for a crime laboratory and we utilize a type of DNA fingerprinting technique for catching criminals. We look at short tandem repeats (STRs), which are areas in the DNA that have three to four base pair repeats (e.g. AGATAGATAGATAGATAGAT). We are able to amplify or copy several different regions (called loci) of DNA that are known to have these repeat sequences. A region or loci with more repeats will be longer (because there are more base pairs). As such, we are able to determine the number of repeats in a particular locus by how long these regions are. For example, TPOX is a STR we use. You might have 8 repeats in TPOX region. Since you get one copy of your DNA from mom and the other from dad, some regions will have two different repeat numbers. For example, you might be an 8 and 9 repeat for TPOX. We look at many different regions of your DNA, which allow us to put together a genetic profile that can be used to identify you (your genetic fingerprint).

When we get evidence in, we look biological material that may be there (like blood) and then isolate the DNA. We then quantify the DNA and amplify it using special chemicals that allow us to figure out the genetic profile of the person that left the biological material on the evidence. This is then compared to the known profile of any suspects or other people that may have had contact with the evidence.


Answer 2:

I'm afraid I work with plants, and what we do with them is is called "microsatellite markers". They help us know which plants are related to which other plants.



Click Here to return to the search form.

University of California, Santa Barbara Materials Research Laboratory National Science Foundation
This program is co-sponsored by the National Science Foundation and UCSB School-University Partnerships
Copyright © 2015 The Regents of the University of California,
All Rights Reserved.
UCSB Terms of Use